• Fig. 1: Risultati dell’amplificazione dei campioni reperiti per la prova del marcatore SCAR15 (Kim et al. 2008). 1. 101-14 Millardet (1); 2. 3309 Couderc; 3. 5BB Kober; 4. SO4 (Selektion Oppenheim No. 4); 5. Rupestris Du Lot; 6. Muscat Hamburg; 7. Sauvignon; 8. Koushu; 9. Kyoho; 10. Thompson Seedles; 11. Vitis Labrusca; 12. Vitis Riparia; 13. 101-14 Millardet (2); 14. Vitis amurensis chinensis; 15. Vitis amurensis chinensis x Ruländer // SCAR 15 (Kim et al., 2008) amplification results for the following samples: 1. 101-14 Millardet (1); 2. 3309 Couderc; 3. 5BB Kober; 4. SO4 (Selektion Oppenheim No. 4); 5. Rupestris Du Lot; 6. Muscat Hamburg; 7. Sauvignon; 8. Koushu; 9. Kyoho; 10. Thompson Seedles; 11. Vitis Labrusca; 12. Vitis Riparia; 13. 101-14 Millardet (2); 14. Vitis amurensis chinensis; 15. Vitis amurensis chinensis x Ruländer.
    Show Jump to

  • Tab. 1: Campioni usati ai fini dell’elaborazione di questo studio, la loro provenienza e la resistenza alla malattia che si è cercato di individuare con l’ausilio dei marcatori molecolari // Samples used for this research study with their origin and the disease resistance.
    Show Jump to

  • Tab. 2: Primers utilizzati ai fini di questo studio //Primers used in this study.
    Show Jump to

  • Tab. 3: Condizioni PCR per l’amplificazione dei singoli marcatori // PCR conditions for markers amplification.
    Show Jump to

  • Tab. 4: Risultati dell’analisi dei campioni per l’individuazione della resistenza a fillossera con i diversi marcatori. In grassetto i frammenti associati alla resistenza. L = Laimburg; T = Termeno; F = Fondazione Edmund Mach; TMD = Trauttmansdorff // Results from molecular marker analysis for Phylloxera resistance. In bold, fragments associated to resistance. L = Laimburg; T = Termeno; F = Fondazione Edmund Mach; TMD = Trauttmansdorff.
    Show Jump to

  • Tab. 5: Analisi effettuata con i diversi marcatori molecolari per l’individuazione della regione di resistenza Rcg1 contro il tumore batterico p = presenza; a = assenza // Analysis with different molecular markers associated to Rcg1 resistance to crown gall disease p= presence; a = absence.
    Show Jump to

Full Paper

Analisi di accessioni di vite con marcatori molecolari associati a geni di resistenza a filossera, antracnosi e tumore batterico

Molecular analysis of resistance genes against phylloxera, antracnosis and crown gall disease in a collection of different grapevine accessions
Genetische Untersuchungen von Krankheitsresistenzen gegenüber Reblaus, Anthraknose und Mauke in einer Rebsortensammlung
Margot Raffeiner1, Elena Zini1, Thomas Letschka1
1 Versuchszentrum Laimburg

Abstract

In the year 2012 the Laimburg Research Centre, in collaboration with the Autonomous Province of Bolzano and the private platform InnoVitis in Marlengo, has started a project called RebSelect with the aim to characterise a collection of about 150 grapevine accessions of particular interest for the presence of resistance genes to fungal and other diseases. The objectives of the project are the creation of a grape genetic bank by molecular methods (MAS, marker assisted selection), to identify resistance genes to various diseases in this collection and to select resistant plants to be used as parents in the next crossings. This will be helpful for the establishment of new resistant varieties with high quality. In this thesis, we have focused on genomic regions related to the resistance to phylloxera (Viteus vitifoliae), crown gall (Agrobacterium vitis) and anthrachnose (Elsinoë ampelina), utilizing microsatellite or SCAR markers already published in the literature. It is shown that the markers suitable for the MAS and usable for the identification of resistant varieties (used subsequently for further crossings for the purposes of genetic improvement) are those for Rdv1, associated with resistance to phylloxera. For the resistance to crown gall disease (Rcg1) the results are controversial, making these markers not exploitable for MAS: a fine mapping of the designated area will be necessary to search for markers closer to Rcg1. Finally, the only marker that appeared to be associated to resistance against anthracnose needs to be discarded due to false positive results for all analysed accessions.
Das Versuchszentrum Laimburg hat 2012 in Zusammenarbeit mit der Autonomen Provinz Bozen und der privaten Plattform InnoVitis das Projekt RebSelect ins Leben gerufen. Ziel dieses Projektes ist der Aufbau einer Sammlung von über 150 verschiedenen Rebsorten und deren Untersuchung auf die Anwesenheit von Krankheitsresistenzen, insbesondere gegen Pilzkrankheiten. Mit Hilfe molekularbiologischer Methoden (MAS, Marker-assistierte Selektion) werden die entsprechenden Resistenzgene erfasst und jene Rebsorten ermittelt, die sich aufgrund einer hohen Anzahl von Resistenzgenen besonders für neue Züchtungskreuzungen eignen. Diese Diplomarbeit richtet ihren Fokus auf Genregionen, die mit einer Resistenz gegen Rebläuse (Viteus vitifoliae), Mauke (Agrobacterium vitis) oder Anthraknose (Elsinoë ampelina) assoziiert sind, und bedient sich dabei bereits veröffentlichter Genmarker (SCAR und Mikrosatelliten). Es konnte festgestellt werden, dass sich besonders jene Marker für einen Einsatz in der MAS eignen, die mit einer Reblaus-Resistenz (Rdv1) verbunden sind. Die Untersuchungen zur Resistenz gegen Mauke (Rcg1) und Antraknose ergaben widersprüchliche Ergebnisse und bedürfen genauerer Analysen der betroffenen Genbereiche für einen zuverlässigen Einsatz der Marker in Routineanalysen.
Il Centro di Sperimentazione Laimburg nel 2012 ha avviato un progetto denominato RebSelect, in collaborazione con la Provincia Autonoma di Bolzano e con la piattaforma privata Innovitis di Marlengo. Tale progetto ha lo scopo di caratterizzare una collezione che consiste di ca. 150 accessioni di vite di particolare interesse per la presenza di geni di resistenza noti contro malattie fungine e non. Il progetto ha come obiettivo la realizzazione di una banca genetica di varietà di vite e l’utilizzo di una metodica molecolare (MAS, selezione assistita da marcatori) per l’individuazione di geni di resistenza a varie malattie nella collezione; in seguito, l’identificazione di piante resistenti da utilizzare come genitori di incrocio potrà essere utile per la costituzione di nuove varietà resistenti e di alta qualità. In questo lavoro di tesi ci si è concentrati sulle regioni genomiche deputate alla resistenza per fillossera (Viteus vitifoliae), tumore batterico (Agrobacterium vitis) e antracnosi (Elsinoë ampelina), prendendo in considerazione marcatori di tipo microsatellite o di tipo SCAR già pubblicati in letteratura. Dalle analisi eseguite, viene mostrato che i marcatori adatti per la MAS e utilizzabili per l’identificazione di varietà resistenti, impiegate successivamente per ulteriori incroci ai fini di un miglioramento genetico, sono quelli per Rdv1, cioè i marcatori associati alla resistenza a fillossera. Per la resistenza a tumore batterico, Rcg1, i risultati sono discordanti, rendendo questi marcatori inutilizzabili per la MAS: per questa regione, probabilmente, è necessario un mappaggio più fine della zona deputata e una ricerca di marcatori più vicini al gene o ai geni di resistenza al tumore batterico. Infine, per quanto riguarda la resistenza ad antracnosi, l’unico marcatore che sembra essere associato è da scartare completamente poiché da risultati falsi positivi per tutte le accessioni utilizzate nelle analisi.

Introduzione

Malattie secondarie della vite

La vite è soggetta a numerose malattie che riducono notevolmente la resa annuale dei prodotti sia nella produzione di vini che nella semplice produzione di uva da tavola. Queste malattie obbligano l’utilizzo di fitosanitari che potrebbero però risultare inquinanti sia per l’uomo che per l’ambiente. Da dati forniti dal resoconto sull’utilizzo dei prodotti per la protezione delle piante dell’Unione Europea è emerso che due terzi della quantità totale di fungicidi utilizzati in Europa vengono applicati nei vigneti (Eurostat, 2007) [1].
×
  • [1] Eurostat (2007). The Use of Plant Protection Products in The European Union.

Le malattie più diffuse sono la peronospora o l’oidio, ma esistono anche malattie come il tumore batterico, l’antracnosi o la malattia causata dall’insetto fillossera, che sono stati oggetto di studio in questo elaborato.

La fillossera della vite (Viteus vitifoliae, Fitch 1856) è un insetto assomigliante all’afide che attacca le radici primarie di Vitis vinifera. Essa causa la formazione di strutture deformi simili a galle che vengono chiamate nodosità (se interessano la cortex della radice) o tuberosità (nel caso interessino parti più vecchie del legno radicale). Il primo tipo può essere meno dannoso, il secondo tipo può portare, insieme ad altre infezioni fungine secondarie, alla morte della pianta. Il parassita è stato accidentalmente introdotto dall’America in Europa a metà del XIX secolo causando danni alle cultivar europee che portano ottime caratteristiche qualitative ma risultano suscettibili alla malattia causata da questo insetto. Gli allevatori si sono impegnati a introdurre le caratteristiche di resistenza esistenti nelle specie selvatiche americane e asiatiche utilizzandoli come portainnesti per piante di cultivar europee. Si è visto che il portainnesto Börner, risultato di un incrocio tra le specie selvatiche Vitis riparia e Vitis cinerea Arnold (Zhang et al., 2009) [2], mostra un elevato grado di resistenza, con una risposta di tipo ipersensibile e lo sviluppo di necrosi locali.
×
  • [2] Zhang J., Hausmann L., Eibach R., Welter L. J., Töpfer R., Zyprian E. M. (2009). A framework map from grapevine V3125 (Vitis vinifera ‘Schiava grossa’בRiesling’) × rootstock cultivar ‘Börner’ (Vitis riparia × Vitis cinerea) to localize genetic determinants of phylloxera root resistance. Theoretical and Applied Genetics 119 (6), 1039-1051. doi: 10.1007/s00122-009-1107-1.

Agrobacterium vitis è un batterio che causa un’anomala proliferazione cellulare, chiamata tumore batterico, con la formazione di galle nel colletto della pianta o di radici sottili e filamentose (hairy root). Il patogeno può vivere nel suolo per brevi periodi ed entra nelle piante attraverso il sistema radicale colonizzando il tessuto xilematico. La vite in questa fase non mostra sintomi e di solito è necessario che avvenga una lesione del tessuto per l’inizio della produzione di galle. Questi inibiscono la crescita del tessuto vascolare a causa della mancata traslocazione di nutrimenti e possono portare anche alla morte della pianta. Il batterio contiene un plasmide, piccolo frammento di DNA circolare e superavvolto presente nel citoplasma, in grado di inserirsi nel genoma vegetale e di introdurre tumori (T-DNA) attraverso dei geni di virulenza e geni per la sintesi di opine. Una pianta ferita produce polifenoli che attivano la regione di virulenza. Il T-DNA è trasferito all’interno della cellula vegetale, viene integrato nel DNA vegetale e causa la produzione di ormoni e opine, responsabili della moltiplicazione delle galle in generale. Le cultivar di Vitis vinifera sono altamente suscettibili a questo tipo di agente patogeno, ma esistono specie selvatiche di vite, tra le quali Vitis amurensis e Vitis labrusca, che possiedono genotipi resistenti.

L’antracnosi è una malattia causata da infezione da parte del fungo parassita Elsinoë ampelina (Shaer, 1929). Il fungo attacca prevalentemente le parti giovani e più attive della pianta, come foglie o germogli e si manifesta con piccole macchie scure sulle foglie specialmente in vicinanza alle nervature. Da qui inizia il graduale disseccamento che determina riduzione di sviluppo della pianta, indebolimento e infine perdita di produzione. Questa malattia porta, inoltre, alla formazione di cancri profondi sui piccioli delle foglie e di macchie depresse sugli acini che in questo modo non sono in grado di maturare (Goidànich et al., 1990) [3]. Anche contro questa malattia determinate varietà di vite hanno sviluppato delle resistenze ed è stato osservato che nella maggior parte delle piante la resistenza viene originata dalla specie selvatica Vitis labrusca. Questi studi hanno individuato anche altre piante derivate da Vitis rupestris e da incroci di Vitis riparia x Vitis rupestris che hanno mostrato tale resistenza (Kim et al., 2008) [4]
×
  • [3] Goidànich G., Casarini B., Ugolini A. (1990). La difesa delle piante da frutto. Edizione Agricole.
  • [4] Kim G. H., Yun H. K., Choi C. S., Park J. H., Jung Y. J., Park K. S., ... Kang K. K. (2008). Identification of AFLP and RAPD markers linked to anthracnose resistance in grapes and their conversion to SCAR markers. Plant breeding 127 (4), 418-423. doi: 10.1111/j.1439-0523.2008.01488.x.

Geni di resistenza e marcatori molecolari

Le possibilità che la pianta ha di contrastare l’attacco dei patogeni e i tipi di meccanismo che utilizza dipendono dalle sue caratteristiche genetiche (Matta et al., 1996) [5]. I tratti genetici che conferiscono la resistenza a determinate malattie spesso non sono costituiti da singoli geni, ma da regioni cromosomiche che includono numerosi QTLs (Quantitative Trait Loci) all’interno del genoma della pianta. Lo sviluppo e l’utilizzo di marcatori molecolari per la determinazione di polimorfismi nel DNA è uno dei maggiori progressi fatti nel campo della biologia molecolare negli ultimi anni. I microsatelliti sono attualmente considerati tra i marcatori più utili sopratutto a causa dell’elevato grado di polimorfismo. Ma anche l’utilizzo dei marcatori SCAR (Sequence Characterized Amplified Region) ha raggiunto una certa importanza nelle ricerche della biologia molecolare a causa della facilità di effettuare una diagnosi di presenza/assenza utilizzando delle tecniche facili e veloci.
×
  • [5] Matta A., Luisoni E., Surico G. (1996). Fondamenti di Patologia vegetale. Pàtron, Bologna, Italia.

La selezione assistita da marcatori (MAS, Marker Assisted Selection) è una tecnica di selezione genetica che consente di individuare caratteri d’interesse attraverso l’impiego di marcatori genetici. La MAS permette di anticipare i tempi di selezione, di inserire in una singola pianta più fonti di resistenza o altre caratteristiche desiderate, di analizzare più di una caratteristica contemporaneamente e di eliminare tratti del genoma associati a caratteri indesiderati (ricombinazioni). Nel caso di resistenza a malattie la finalità della MAS è quella di ottenere piante con una resistenza durevole, cioè una resistenza che rimane effettiva in maniera prolungata nel tempo e in un ambiente favorevole allo sviluppo del patogeno o dei patogeni. La necessità di piramidizzare le resistenze, cioè di avere più resistenze per una stessa malattia all’interno della stessa pianta, nasce dal fatto che alcuni patogeni sono riusciti ad evolversi fino a riuscire a superare in alcuni casi un tipo di resistenza. Nel caso siano presenti due o più tratti genomici che individuano resistenze di tipo diverso per lo stesso patogeno, la capacità del patogeno di superare tutti i meccanismi di resistenza risulta essere molto bassa, per cui si può parlare di piante con resistenza durevole o resistenza ad ampio spettro. Un altro aspetto è invece piramidizzare geni di resistenza a patogeni diversi, il che porta indubbiamente all’avere più caratteristiche positive nello stesso individuo.

Il Centro di Sperimentazione Laimburg nel 2012 ha avviato un progetto denominato RebSelect con lo scopo di caratterizzare una collezione che consiste in ca. 150 varietà di vite di particolare interesse per la presenza di geni di resistenza noti contro malattie fungine e non. Il progetto ha come obiettivo la realizzazione di una banca genetica di varietà di vite e l’utilizzo di una metodica molecolare (MAS) per l’individuazione di geni di resistenza a varie malattie nella collezione: l’identificazione di piante resistenti da utilizzare come genitori di incrocio potrà essere utile per la costituzione di nuove varietà resistenti e di alta qualità.

Materiali e metodi

Materiale vegetale

Per gli esperimenti necessari ai fini di questo studio sono state analizzate foglie giovani da accessioni prelevati presso la piattaforma vitivinicola InnoVitis di Marlengo ed il Centro di Sperimentazione Laimburg (Tab. 1).

Tab. 1: Campioni usati ai fini dell’elaborazione di questo studio, la loro provenienza e la resistenza alla malattia che si è cercato di individuare con l’ausilio dei marcatori molecolari // Samples used for this research study with their origin and the disease resistance.

+

Accessione accession

Analisi resistenza analyzed resistance

Donatore resistenza nel pedigree resistance donor in pedigree

Provenienza origin

Börner F

fillossera

Vitis cinerea

FEM

Börner L

fillossera

Vitis cinerea

InnoVitis

Börner V

fillossera

Vitis cinerea

Vivaio Verona

Vitis cinerea

fillossera

Vitis cinerea

FEM

Vitis cinerea TMD

fillossera

Vitis cinerea

Trauttmansdorff

Vitis riparia

antracnosi

sconosciuta

Laimburg

101-14 Millardet et Grasset

antracnosi

sconosciuta

Laimburg

3309 Couderc

antracnosi

sconosciuta

Laimburg

5BB Kober

antracnosi

sconosciuta

Laimburg

Selektion Oppenheim 4

antracnosi

sconosciuta

Laimburg

Rupestris Du Lot

antracnosi

sconosciuta

Laimburg

Muscat Hamburg

antracnosi

sconosciuta

Laimburg

Koushu

antracnosi

sconosciuta

Laimburg

Kyoho

antracnosi

sconosciuta

Laimburg

Thompson seedless

antracnosi

sconosciuta

Laimburg

Vitis labrusca

antracnosi

sconosciuta

Laimburg

Vitis amurensis chinensis

antracnosi/tumore batterico

sconosciuta/Vitis amurensis

InnoVitis

Vitis amurensis x Ruländer

antracnosi/tumore batterico

sconosciuta/Vitis amurensis

InnoVitis

Vitis amurensis x Traminer

antracnosi/tumore batterico

sconosciuta/Vitis amurensis

InnoVitis

01-1-768

tumore batterico

Vitis amurensis

InnoVitis

54-2

tumore batterico

Vitis amurensis

InnoVitis

9-16-6a

tumore batterico

Vitis amurensis

InnoVitis

Baron

tumore batterico

Vitis amurensis

InnoVitis

Bruscam

tumore batterico

Vitis amurensis

InnoVitis

Cabernet Carbon

tumore batterico

Vitis amurensis

InnoVitis

Cabernet Carol

tumore batterico

Vitis amurensis

InnoVitis

Cabernet Cortis

tumore batterico

Vitis amurensis

Laimburg

Jasmin

tumore batterico

Vitis amurensis

InnoVitis

Kunbarat

tumore batterico

Vitis amurensis

Udine

Lu1

tumore batterico

Vitis amurensis

InnoVitis

Lu2

tumore batterico

Vitis amurensis

InnoVitis

Michurinets

tumore batterico

Vitis amurensis

Udine

Monarch

tumore batterico

Vitis amurensis

InnoVitis

Muscaris

tumore batterico

Vitis amurensis

Laimburg

Semonell

tumore batterico

Vitis amurensis

InnoVitis

Severnyi

tumore batterico

Vitis amurensis

Udine

Souvignier gris

tumore batterico

Vitis amurensis

InnoVitis

Zarya Severa

tumore batterico

Vitis amurensis

Udine

Pinot Noir

controllo negativo

InnoVitis

Sauvignon

controllo negativo

Laimburg

Per il prelievo del materiale fogliare è stato utilizzato un Harris Uni-Core™ puncher (Finnzymes) per tagliare un dischetto fogliare del diametro di 0.5 mm e collocarlo direttamente nel mastermix per l’amplificazione del materiale genetico tramite PCR senza una precedente estrazione e purificazione del DNA. L’amplificazione del DNA ottenuto è stato confrontato con l’amplificazione del DNA da materiale vegetale ottenuto usando il kit di estrazione DNeasy Plant Mini Kit (Qiagen). Per individuare la concentrazione di acidi nucleici contenuta in ogni campione, si ha effettuato una misurazione spettrofotometrica con lo spettrofotometro NanoDrop (Thermo Scientific) con successiva diluizione per arrivare a una concentrazione standardizzata di 25 ng/µl.

Amplificazione del DNA

Per l'amplificazioni dei microsatelliti veniva utilizzato il KAPA3G Plant PCR Kit (Kapa Biosystems) mentre per lo SCAR la reazione di allestimento della PCR è avvenuta con l’utilizzo della Taq polimerasi Green GoTaq (Promega) utilizzando i primer elencati in Tabella 2 e le condizioni descritti in Tabella 3. La separazione dei prodotti ottenuti tramite PCR è avvenuta tramite elettroforesi su gel d’agarosio da 1% nel caso dello SCAR oppure tramite elettroforesi capillare utilizzando il sequenziatore automatico CEQ8800 (Beckman Coulter).

Tab. 2: Primers utilizzati ai fini di questo studio // Primers used in this study.

+

Gene name

Oligo name

Sequence fwd

Sequence rev

Rdv1

GF13-1 F

[D2-PA] GTTGGAGAGTCTGAGATGGTG

TGGTGCTACTTCTCAGAAGCATC

Rdv1

GF13-9 F

[D2-PA] CAGTGTGTGTTCAGAACAGGAC

GGAATTGACCAACCTCTTTCCTAC

Rdv1

GF13-11 F

[D3-PA] CCGTTGAGACTGTTTGTTCAGC

GCATCTTCAAAAGTAAGCAGAACC

Rdv1

VMC9h4-2 F

[D2-PA] GCAGTTGATGCAAAACAACAGT

CACATCATTCATTGATGAGGCT

Rcg1

UDV015 F

[D4-PA] TGCACATTTCCCTCCTTAG

CGGGTTACTGGGAAGGGTAT

Rcg1

VVS16 F

[D3-PA] TCAAACTATTATTCAAACCAAAGTACG

TCGATTTCAACAAATTTAGAAATATG

Rcg1

9M3-3 F

CAAGTGGCTCTTCTCCATA

GGTGTGATGTAGAGTGAAAC

Antracnosi

SCAR15 F

CGGCAGACCTTACTGAAAGGATGAGT

CAACCACCATCCAATGATGGCTGGGCTTCTG

Tab. 3: Condizioni PCR per l’amplificazione dei singoli marcatori // PCR conditions for markers amplification.

+

Gf13-1, Gf13-9, Gf13-11 e VMC9h4.2

UD015 e VVS16

94° per 10 minuti

94° per 10 minuti

94° per 1 minuto

40 cicli

94° per 30 secondi

35 cicli

60° per 1 minuto

55° per 1 minuto

72° per 2 minuti

72° per 30 secondi

estensione finale: 72°C per 30 minuti

estensione finale: 72 °C per 30 minuti

9M3-3

SCAR15

94° per 10 minuti

94° per 2 minuti

94° per 1 minuto

35 cicli

94° per 1 minuto

40 cicli

52° per 1 minuto

65° per 1 minuto

72° per 1 minuto

72° per 90 secondi

estensione finale: 72 °C per 30 minuti

estensione finale: 72 °C per 7 minuti

Risultati e discussione

Fillossera

Attraverso la creazione di una mappa genetica e la valutazione fenotipica della resistenza a fillossera in una popolazione segregante per la resistenza, è stato possibile identificare un QTL denominato Rdv1 localizzato sul linkage group 13. I marcatori di tipo microsatellite presenti nell’intorno del QTL sono GF13-1, GF13-9, GF13-11 e VMC9h4.2 (Zhang et al., 2009) [2]; tali microsatelliti sono stati utilizzati anche in un lavoro successivo di Eibach et al. (2010) [6] confermando la loro applicabilità nella MAS.
×
  • [2] Zhang J., Hausmann L., Eibach R., Welter L. J., Töpfer R., Zyprian E. M. (2009). A framework map from grapevine V3125 (Vitis vinifera ‘Schiava grossa’בRiesling’) × rootstock cultivar ‘Börner’ (Vitis riparia × Vitis cinerea) to localize genetic determinants of phylloxera root resistance. Theoretical and Applied Genetics 119 (6), 1039-1051. doi: 10.1007/s00122-009-1107-1.
  • [6] Eibach R., Hausmann L., Töpfer R. (2010). Marker assisted selection (MAS) as a new tool for developing high quality cultivars with sustainable resistance. XXXIII World Congress of Vine and Wine 20-25 June 2010, Tbilisi, Georgia.
È stata individuata un'accessione portatrice di resistenza nel portainnesto Börner, presente nella collezione delle accessioni del progetto RebSelect. Per avere un confronto con altri campioni disponibili di Börner, sono stati reperiti campioni vegetali del portainnesto presso la collezione della Fondazione Edmund Mach di San Michele all'Adige (grazie alla collaborazione con la Dott.ssa Stella Grando) e un campione vegetale proveniente dal Vivaio Gutmann, Termeno (BZ). Inoltre è stato recuperato un campione di Vitis riparia e uno di Vitis cinerea, ipotetico donatore della resistenza, sempre proveniente dalla Fondazione Edmund Mach per poter ricostruire il pedigree di Börner e valutare la provenienza della resistenza. Si è proceduto quindi con l’amplificazione di questi due campioni con i marcatori sopra descritti. La lunghezza attesa dell’allele associato alla resistenza per il marcatore Gf13-1 è di 211 bp e la lunghezza attesa dell’allele per Gf13-9 è di 336 bp (Zhang et al., 2009) [2]. Per quanto riguarda gli altri due marcatori, per VMC9h4.2 la lunghezza attesa è di 250 bp, mentre quella del marcatore Gf13- 11 è di 208 bp (Eibach, R., Julius-Kühn-Institut, Germania, comunicazione personale). Sono stati individuati gli alleli sia in Vitis cinerea che in Börner (Tab. 4).
×
  • [2] Zhang J., Hausmann L., Eibach R., Welter L. J., Töpfer R., Zyprian E. M. (2009). A framework map from grapevine V3125 (Vitis vinifera ‘Schiava grossa’בRiesling’) × rootstock cultivar ‘Börner’ (Vitis riparia × Vitis cinerea) to localize genetic determinants of phylloxera root resistance. Theoretical and Applied Genetics 119 (6), 1039-1051. doi: 10.1007/s00122-009-1107-1.

Tab. 4: Risultati dell’analisi dei campioni per l’individuazione della resistenza a fillossera con i diversi marcatori. In grassetto i frammenti associati alla resistenza. L = Laimburg; T = Termeno; F = Fondazione Edmund Mach; TMD = Trauttmansdorff // Results from molecular marker analysis for Phylloxera resistance. In bold, fragments associated to resistance. L = Laimburg; T = Termeno; F = Fondazione Edmund Mach; TMD = Trauttmansdorff.

+

Accessione accession

GF13-1

GF13-9

GF13-11

VMC9h4.2

Pinot Noir

206.10

223.08

352.16

233.28

237.38

275.64

301.02

Sauvignon

204.22

206.15

339.71

349.74

237.67

296.51

268.83

301.26

101-14

212.03

333.94

346.46

217.15

228.26

256.36

264.85

Alfa

204.22

211.87

334.23

212.76

228.25

244.34

258.94

Leon Millot

213.84

223.45

334.40

354.93

212.92

237.84

255.64

289.77

Vitis riparia

212.32

214.24

329.03

341.30

217.22

255.78

264.25

Börner L

213.65

223.21

342.27

352.10

217.12

219.15

256.75

265.53

Börner T

212.54

217.22

329.58

339.68

213.27

217.36

252.71

260.07

Börner F

212.44

217.10

340.97

361.71

213.53

217.63

252.47

256.72

Vitis cinerea TMD

211.34

217.17

338.92

345.26

213.73

215.82

252.10

Vitis cinerea

211.82

217.62

338.82

344.99

212.66

214.76

251.33

Dai risultati è possibile notare che il campione di Börner della collezione presente a Laimburg non è la pianta del portainnesto che si credeva fosse. È stato possibile verificare questo dato con un semplice confronto del suo profilo genetico e delle altre accessioni di Börner raccolte presso altri luoghi con il profilo genetico di entrambi i suoi genitori, cioè Vitis cinerea e Vitis riparia. Individuando gli alleli di resistenza provenienti da Vitis cinerea, il profilo di Börner risulta così composto:

Vitis cinerea

Börner

212:217

212:217

(Gf13-1)

339:345

329:339

(Gf13-9)

213:215

213:217

(Gf13-11)

252:252

252:256

(VMC9h4.2)

All’interno della collezione non erano presenti genotipi derivanti da Börner o da Vitis cinerea. Tuttavia presso l'orto botanico del Castello di Trauttmansdorff (Merano, BZ) sono presenti alcune accessioni di vite il cui genotipo è sconosciuto. Tra le 11 piante disponibili, una è stata attribuita, tramite osservazione fenotipica, a Vitis cinerea. Si è quindi proceduta all’analisi del DNA per ricostruire il profilo allelico con i marcatori associati alla resistenza a fillossera. Come si evince dalla tabella, Vitis cinerea TMD (sigla per Trauttmansdorff) ha un profilo identico a Vitis cinerea proveniente dai campi sperimentali di Laimburg, per cui può essere verosimilmente attribuita alla specie di vite che dona la resistenza a fillossera.

Tumore Batterico

Qualche decennio fa la resistenza a tumore batterico proveniente da Vitis amurensis è stata introgressa in Vitis vinifera attraverso incroci interspecifici ed è stato mostrato che tale resistenza è ereditata come un carattere mendeliano singolo e dominante (Szegedi et al., 1984) [7]. Successivamente Kuczmog et al. (2012) [8] hanno identificato la regione della resistenza a questo fungo, denominata Rcg1, sul linkage group 15 di Kunbaràt, un ibrido resistente al tumore batterico che deriva dall’incrocio tra un ibrido F2 di Vitis amurensis 115 x Vitis vinifera (resistente) e Vitis vinifera cultivar Italia (suscettibile). Anche in questo caso l’approccio utilizzato è stato quello di creare una mappa genetica e attraverso la fenotipizzazione della resistenza a tumore batterico individuare i tratti genetici deputati a tale resistenza.
×
  • [7] Szegedi E., Korbuly J., Koleda I. (1984). Crown gall resistance in East-Asian Vitis species and in their Vitis vinifera hybrids. Vitis 23 (1), 21-26.
  • [8] Kuczmog A., Galambos A., Horváth S., Mátai A., Kozma P., Szegedi E., Putnoky P. (2012). Mapping of crown gall resistance locus Rcg1 in grapevine. Theoretical and Applied Genetics 125 (7), 1565-1574. doi: 10.1007/s00122-012-1935-2.
È stato possibile individuare la regione genomica responsabile della resistenza al tumore batterico grazie all’utilizzo dei marcatori molecolari UDV015, VVS16 e 9M3-3. Questi marcatori fiancheggiano la regione Rcg1 e si trovano a diverse distanze da essa; UDV015 dista 4.8 cM da Rcg1, trovandosi a monte, mentre 9M3-3 e VVS16 si trovano 3.3 cM e 7.0 cM a valle da essa.Dallo studio svolto da Kuczmog et al. (2012) [8] emerge che la presenza della resistenza è individuabile con la presenza di un allele di 300 bp per il marcatore UDV015, di 500 bp per 9M3-3 e di 260 bp per VVS16. A seconda di quale strumento di elettroforesi capillare si usa, è possibile notare una deviazione dalle lunghezze dei frammenti (Tabella 5). In questo caso l’allele di resistenza individuato con UDV015 si discosta di 2-3 bp (allele resistente ca. 297-298 bp) per VVS16 i frammenti si aggirano a ca. 274 bp. Il marcatore 9M33, trattandosi di uno SCAR, viene analizzato con il metodo di elettroforesi su gel di agarosio e ci si aspetta una banda a ca. 500 bp (immagini non mostrate).
×
  • [8] Kuczmog A., Galambos A., Horváth S., Mátai A., Kozma P., Szegedi E., Putnoky P. (2012). Mapping of crown gall resistance locus Rcg1 in grapevine. Theoretical and Applied Genetics 125 (7), 1565-1574. doi: 10.1007/s00122-012-1935-2.

Tab. 5: Analisi effettuata con i diversi marcatori molecolari per l’individuazione della regione di resistenza Rcg1 contro il tumore batterico p = presenza; a = assenza // Analysis with different molecular markers associated to Rcg1 resistance to crown gall disease p = presence; a = absence.

+

Accessione accession

UDV015

9M3-3

VVS16

Jasmin

281.26

296.83

p

291.14

-

Kunbarat

290.40

298.07

p

274.21

292.11

A. chinensis

297.10

-

p

272.76

290.20

Lu1

297.20

301.01

p

273.25

290.70

A. chinensis x Traminer

291.05

296.85

-

268.72

291.50

Semonell

273.63

-

a

-

-

A. chinensis x Ruländer

284.46

298.09

p

291.02

-

Michurinets

291.74

297.57

p

269.02

291.72

Severnyi

291.98

301.73

p

273.76

291.24

Zarya Severa

275.78

299.14

p

273.25

296.84

54-2

291.30

299.09

a

290.62

-

Bruscam

291.28

299.13

a

268.50

290.95

Lu2

291.41

297.24

p

290.93

-

9-16-6a

285.33

298.97

a

290.67

-

01-1-768

284.75

290.56

a

290.33

-

Pinot Noir

285.66

291.51

a

291.43

-

Monarch

291.81

297.64

a

282.46

291.65

Cabernet Cortis

291.49

297.26

a

291.55

-

Souvignier gris

285.35

299.00

a

290.96

-

Cabernet Carbon

290.70

300.45

a

273.02

290.76

Baron

-

-

a

-

-

Cabernet Carol

290.87

296.71

a

290.81

-

Muscaris

-

-

a

291.20

-

È stata dunque allestita dapprima una PCR con questa pianta di riferimento, Kunbarát, insieme ad altre 25 accessioni che all’interno del loro pedigree contengono Vitis amurensis, ipotetico donatore della resistenza. È stato inserito all’interno dello studio anche Pinot Noir, avendo in tal modo un controllo negativo all’interno di ogni PCR per verificare il corretto funzionamento della reazione.

Sono stati individuati gli alleli resistenti per UDV015 (ca. 297 bp), VVS16 (ca. 274 bp) e 9M3-3 (ca. 500 bp) sia in accessioni di Vitis amurensis (o da essa derivate) che in Kunbaràt.

Si è riuscito ad individuare la presenza di alleli di resistenza per tutti e tre i marcatori sia nella pianta di riferimento Kunbarát, sia in altre piante come Vitis amurensis chinensis e Lu1 (evidenziati in grigio), mentre in altri campioni (Jasmin, Vitis amurensis x Ruländer, Michurinets e Lu2, evidenziati solamente in grassetto) gli alleli della resistenza erano presenti solo per UDV015 e 9M3-3, mentre risultava assente l’allele resistente per VVS16, il marcatore più distante da Rcg1 (Tab. 5).

Severnyi e Zarya Severa invece sono stati trovati 'positivi' per due di tre marcatori, 9M3-3 e VVS16, negativi invece per UDV015 (vedi campioni con asterisco). Il controllo negativo Pinot Noir è privo di alleli resistenti.

Antracnosi

Per quanto riguarda l’antracnosi non è stata trovata una regione genica definita che sia coinvolta nel conferimento della resistenza a questo fungo; tuttavia è stato individuato un marcatore molecolare SCAR (denominato SCAR15), in grado di discriminare piante che mostrano resistenza da piante suscettibili alla malattia (Kim et al., 2008) [4].
×
  • [4] Kim G. H., Yun H. K., Choi C. S., Park J. H., Jung Y. J., Park K. S., ... Kang K. K. (2008). Identification of AFLP and RAPD markers linked to anthracnose resistance in grapes and their conversion to SCAR markers. Plant breeding 127 (4), 418-423. doi: 10.1111/j.1439-0523.2008.01488.x.

Inizialmente è stata effettuata l’amplificazione del marcatore SCAR15 in alcune accessioni della collezione che dal loro pedigree si poteva ipotizzare poter contenere tale resistenza.

Al tal fine sono stati quindi utilizzati i materiali vegetali di Noah, Isabella e Leon Milot per la ricerca della resistenza aggiungendo un’accessione (Pinot Noir) come controllo negativo. Dal momento che il marcatore SCAR15 è un marcatore di tipo SCAR, per verificare l’avvenuta riuscita dell’amplificazione è stata effettuata un’analisi tramite elettroforesi su gel di agarosio (dati non mostrati). Il frammento atteso è di 1.247 bp.

Dal momento che l‘amplificazione è risultata positiva per tutti i campioni, compreso il controllo negativo, si è cercato di capire il motivo di tale risultato. Per escludere la possibilità di contaminazioni dovuto all’utilizzo dello stesso puncher in più campioni fogliari, è stata effettuata un’estrazione con il DNeasy Plant Mini Kit (Qiagen). Per verificare la qualità del marcatore e cercare di riprodurre fedelmente il lavoro effettuato da Kim et al. (2008) [4], sono stati reperiti i campioni vegetali di alcune accessioni presenti nell’articolo di riferimento. I risultati dell’amplificazione anche in questo caso sono stati tutti positivi, rivelando la presenza del marcatore in tutti i campioni, compresi quelli dove invece ci si aspetta la mancanza di amplificazione (Fig. 1).
×
  • [4] Kim G. H., Yun H. K., Choi C. S., Park J. H., Jung Y. J., Park K. S., ... Kang K. K. (2008). Identification of AFLP and RAPD markers linked to anthracnose resistance in grapes and their conversion to SCAR markers. Plant breeding 127 (4), 418-423. doi: 10.1111/j.1439-0523.2008.01488.x.
+

Fig. 1: Risultati dell’amplificazione dei campioni reperiti per la prova del marcatore SCAR15 (Kim et al. 2008). 1. 101-14 Millardet (1); 2. 3309 Couderc; 3. 5BB Kober; 4. SO4 (Selektion Oppenheim No. 4); 5. Rupestris Du Lot; 6. Muscat Hamburg; 7. Sauvignon; 8. Koushu; 9. Kyoho; 10. Thompson Seedles; 11. Vitis labrusca; 12. Vitis riparia; 13. 101-14 Millardet (2); 14. Vitis amurensis chinensis; 15. Vitis amurensis chinensis x Ruländer // SCAR 15 (Kim et al., 2008) amplification results for the following samples: 1. 101-14 Millardet (1); 2. 3309 Couderc; 3. 5BB Kober; 4. SO4 (Selektion Oppenheim No. 4); 5. Rupestris Du Lot; 6. Muscat Hamburg; 7. Sauvignon; 8. Koushu; 9. Kyoho; 10. Thompson Seedles; 11. Vitis labrusca; 12. Vitis riparia; 13. 101-14 Millardet (2); 14. Vitis amurensis chinensis; 15. Vitis amurensis chinensis x Ruländer.

Per escludere ulteriormente la presenza di eventuali contaminazioni dei reagenti da PCR, le amplificazioni sono state ripetute cambiando le soluzioni dei primers e dei vari reagenti ed inserendo un'amplificazione controllo con acqua al posto del DNA. Solo nel caso dell’amplificazione di questo controllo con acqua la PCR ha dato risultato negativo, conferma del fatto che i primers ed i vari reagenti non erano contaminati. Inoltre si è provveduto di alzare la temperatura di annealing fino a 72 °C per rendere l'appaiamento dei primers il più specifico possibile. La presenza dell’amplificato in qualsiasi campione ha rilevato la non riproducibilità del metodo e dell’utilizzo del marcatore SCAR15 per discriminare le piante resistenti e suscettibili ad antracnosi. Dal momento che il marcatore non è stato considerato affidabile e utilizzabile nel breeding assistito, non sono state effettuate analisi aggiuntive.

Conclusione

Le analisi del presente studio mostrano che i marcatori adatti per la MAS e utilizzabili per l’identificazione di varietà resistenti impiegati successivamente per ulteriori incroci ai fini di un miglioramento enetico sono quelli per Rdv1, cioè i marcatori associati alla resistenza a fillossera. I risultati sono chiari e permettono di discriminare senza dubbio piante resistenti da piante suscettibili.

Per Rcg1 il problema è che in alcuni casi abbiamo la presenza di tutti i marcatori positivi, in altri i più vicini alla zona deputata alla resistenza (UDV015 e 9M3-3) risultano positivi, mentre manca l’allele resistente del marcatore più lontano (VVS16). In altri casi c’è l’assenza per uno dei più vicini (UDV015) mentre sono presenti gli alleli resistenti per 9M33 e VVS16. Questi risultati non permettono però di comprendere se esiste una effettiva resistenza della pianta in questi due ultimi casi. Inoltre, pur usando sempre lo stesso programma di PCR in tutti i campioni e lo stesso metodo di analisi frammenti, si riscontrano spesso delle variazioni nelle lunghezze dei frammenti nella regione di resistenza per il marcatore UDV015. Questo comporta dei dubbi sulla validità di utilizzo di questo marcatore. Probabilmente c’è bisogno di un mappaggio più fine della zona deputata e una ricerca di marcatori più vicini al gene o ai geni di resistenza al tumore batterico.

Per quanto riguarda la resistenza ad antracnosi, il marcatore SCAR15 è da scartare completamente poiché da risultati falsi positivi per tutte le accessioni provate e non riesce a discriminare piante resistenti da quelle suscettibili come invece mostrato nell’articolo di riferimento (Kim et al., 2008) [4].
×
  • [4] Kim G. H., Yun H. K., Choi C. S., Park J. H., Jung Y. J., Park K. S., ... Kang K. K. (2008). Identification of AFLP and RAPD markers linked to anthracnose resistance in grapes and their conversion to SCAR markers. Plant breeding 127 (4), 418-423. doi: 10.1111/j.1439-0523.2008.01488.x.

In questo ultimo caso, gli studi della localizzazione della resistenza sono ancora assenti, per cui probabilmente servirebbe la creazione di una mappa genetica in una popolazione di incrocio segregante per la resistenza ad antracnosi e la ricerca di QTLs in seguito alla fenotipizzazione della malattia. L’individuazione di un marcatore (ipoteticamente) associato non è sufficiente, purtroppo, per determinare in una Marker Assisted Selection la sicurezza della discriminazione tra piante resistenti e suscettibili.

Ringraziamenti

Questo lavoro è stato finanziato dalla piattaforma Innovitis (Marlengo, BZ) e dalla Provincia Autonoma di Bolzano, Ripartizione 34. Si ringrazia per la collaborazione la Dott.ssa Barbara Raifer e Josef Terleth della sezione Viticoltura (Centro di Sperimentazione Laimburg). Un ringraziamento anche al Prof. Paolo Bernardo Trost (Università di Bologna) per la supervisone di questo elaborato di tesi.

Bibliografia

  • [1] Eurostat (2007). The Use of Plant Protection Products in The European Union.
  • [2] Zhang J., Hausmann L., Eibach R., Welter L.J., Töpfer R., Zyprian E.M. (2009). A framework map from grapevine V3125 (Vitis vinifera ‘Schiava grossa’בRiesling’) × rootstock cultivar ‘Börner’ (Vitis riparia × Vitis cinerea) to localize genetic determinants of phylloxera root resistance. Theoretical and Applied Genetics 119 (6), 1039-1051. doi: 10.1007/s00122-009-1107-1.
  • [3] Goidànich G., Casarini B., Ugolini A. (1990). La difesa delle piante da frutto. Edizione Agricole.
  • [4] Kim G.H., Yun H.K., Choi C.S., Park J.H., Jung Y.J., Park K.S., ... Kang K.K. (2008). Identification of AFLP and RAPD markers linked to anthracnose resistance in grapes and their conversion to SCAR markers. Plant breeding 127 (4), 418-423. doi: 10.1111/j.1439-0523.2008.01488.x.
  • [5] Matta A., Luisoni E., Surico G. (1996). Fondamenti di Patologia vegetale. Pàtron, Bologna, Italia.
  • [6] Eibach R., Hausmann L., Töpfer R. (2010). Marker assisted selection (MAS) as a new tool for developing high quality cultivars with sustainable resistance. XXXIII World Congress of Vine and Wine 20-25 June 2010, Tbilisi, Georgia.
  • [7] Szegedi E., Korbuly J., Koleda I. (1984). Crown gall resistance in East-Asian Vitis species and in their Vitis vinifera hybrids. Vitis 23 (1), 21-26.
  • [8] Kuczmog A., Galambos A., Horváth S., Mátai A., Kozma P., Szegedi E., Putnoky P. (2012). Mapping of crown gall resistance locus Rcg1 in grapevine. Theoretical and Applied Genetics 125 (7), 1565-1574. doi: 10.1007/s00122-012-1935-2.

Creative Commons License
Dieses Werk ist lizenziert unter einer Creative Commons Namensnennung - Nicht kommerziell 4.0 International Lizenz.
Quest'opera è distribuita con Licenza Creative Commons Attribuzione - Non commerciale 4.0 Internazionale.
This work is licensed under a Creative Commons Attribution - NonCommercial 4.0 International License.

Für alle Abbildungen und Tabellen ohne Nennung des Urhebers gilt: © Versuchszentrum Laimburg.
Per tutte le immagini e tabelle senza menzione dell'artefice vale: © Centro di Sperimentazione Laimburg.
For all figures and tables without mention of the originator applies: © Laimburg Research Centre.



© 2019 Laimburg Journal

Alle Inhalte sind unter einer CC BY-NC 4.0 International Lizenz veröffentlicht.
Für die Abbildungen im Banner gilt: © Versuchszentrum Laimburg/ Ivo Corrà ©.

Haftungsausschluss (Disclaimer)
Unser Angebot enthält Links zu externen Webseiten Dritter, auf deren Inhalte wir keinen Einfluss haben. Deshalb können wir für diese fremden Inhalte auch keine Gewähr übernehmen. Für die Inhalte der verlinkten Seiten ist stets der jeweilige Anbieter oder Betreiber der Seiten verantwortlich. Die verlinkten Seiten wurden zum Zeitpunkt der Verlinkung auf mögliche Rechtsverstöße überprüft. Rechtswidrige Inhalte waren zum Zeitpunkt der Verlinkung nicht erkennbar. Eine permanente inhaltliche Kontrolle der verlinkten Seiten ist jedoch ohne konkrete Anhaltspunkte einer Rechtsverletzung nicht zumutbar. Bei Bekanntwerden von Rechtsverletzungen werden wir derartige Links umgehend entfernen.